Anti-doping is one of those subjects where the details matter more than the headlines. This page pulls together the background, the mechanisms, and the practical points readers ask about most.
Updated 2026-08-01. Numbers and descriptions here follow the published literature rather than marketing material.
Laboratory studies indicate that GW501516 activates PPARδ, a nuclear receptor involved in fatty acid oxidation and energy metabolism. In rodent experiments, treated animals often showed increased endurance and reduced fat mass. These effects were observed under controlled conditions and do not establish safe or effective use in humans. The exact dose-response relationship in humans remains poorly characterized. Species differences in metabolism can affect how results translate across animals and people.
Safety concerns emerged from long-term animal studies. In rodents given the compound for extended periods, researchers found an increased incidence of certain cancers, including liver and bladder tumors. These findings contributed to the discontinuation of clinical development. Whether similar risks apply to short-term or low-level exposure in humans is not established, and controlled human safety data are limited. The relevance of high-dose rodent carcinogenicity findings to human use remains a subject of debate.
Human trials of GW501516 were small and short in duration. They examined lipid levels, glucose handling, and other metabolic markers, but the programs were halted after the animal cancer findings. No approved therapeutic product exists, and published human data are insufficient for establishing long-term safety. Reports of use for athletic performance come mainly from non-clinical settings and cannot be verified through controlled trials. Independent testing of products sold as cardarine has found inconsistent purity and labeling.
GW501516 binds and activates PPARδ, a nuclear receptor that influences transcription of genes involved in fatty acid oxidation and energy use. Activation shifts some metabolic pathways in preclinical models, which is why the compound has been studied for lipid disorders and exercise-related endpoints. The exact downstream effects in humans are incompletely mapped. PPARδ is expressed in many tissues, including skeletal muscle, liver, and adipose tissue, so broad activation may have varied consequences. Researchers continue to examine how selective or partial activation might alter the balance between benefits and risks.
Published human data are sparse and mostly come from early-phase trials. Those studies examined short-term changes in lipids, glucose, and exercise capacity, but they were not large enough to establish efficacy or long-term safety. Some animal experiments reported increased running endurance, yet such findings do not prove a performance benefit in people. Anti-doping laboratories detect GW501516 and its metabolites in urine or blood using liquid chromatography-tandem mass spectrometry. Detection windows depend on dose, sample type, and individual metabolism. The method is sensitive enough to identify trace residues in tested samples.
Laboratory handling focuses on identity, purity, and stability. Reference standards are typically stored cold and dry, protected from light, because solutions can degrade over time. Analytical checks may use high-performance liquid chromatography with ultraviolet detection or mass spectrometry. Impurities and related substances can be separated chromatographically and compared with a known standard. Because cardarine is not an approved drug, compendial monographs are absent, and laboratories often rely on in-house methods. Reported purity varies among unregulated products and should not be assumed from a label.
| Property | Value | Notes |
|---|---|---|
| Primary target | PPARδ (NR1C2) | Nuclear receptor involved in lipid metabolism |
| Preclinical effect | Increased fatty acid oxidation | Observed in rodent studies |
| Key safety signal | Tumors in rodents after long-term exposure | Contributed to halted clinical development |
| Human trial status | No approved product; development stopped | Limited short-term metabolic data |
| Sport regulatory status | Prohibited at all times | WADA hormone and metabolic modulators class |
At the molecular level, GW501516 binds and activates PPARδ, a nuclear receptor that regulates transcription. Activation shifts expression of genes involved in fatty acid oxidation, energy expenditure, and lipid transport in skeletal muscle and liver. Animal studies report increased endurance and altered lipid profiles after exposure. Human data are limited to small trials and do not establish long-term safety or efficacy. PPARδ also has roles in cell proliferation, so the relationship between activation and cancer risk remains an open question.
Published literature on cardarine includes in vitro assays, rodent experiments, and a small number of human studies. Reports describe effects on exercise capacity and lipid metabolism in animals, while human evidence is sparse. Many online descriptions present the compound as a proven endurance aid, a claim not supported by regulatory approval or large clinical trials. Analytical studies focus on identifying the parent compound and its metabolites in biological samples. Important uncertainties include species differences, dose-response relationships, and the relevance of rodent tumor findings to humans.
Cardarine is prohibited in competitive sport under the World Anti-Doping Agency code, where it is classified as a metabolic modulator. It is not approved as a prescription medicine in the United States, European Union, or other major markets. Regulatory action has focused on its presence in sports and in products marketed as research chemicals. Because it has no accepted medical indication, supply is often unregulated. This status creates legal and safety uncertainties for anyone who encounters the substance.
Anti-doping laboratories detect GW501516 and its metabolites using liquid chromatography-tandem mass spectrometry. Urine is the most common matrix, though blood and dried blood spots may also be used in some programs. Detection depends on factors such as dose, timing, metabolism, and the sensitivity of the assay. Published methods describe limits of detection in the low nanogram per milliliter range for related compounds. Exact detection windows are not fixed for all situations and remain an area of ongoing study.
Products sold as cardarine have been found to contain incorrect compounds, variable amounts, or no active ingredient at all. Independent testing is required to verify identity and purity. Common analytical approaches include high-performance liquid chromatography, mass spectrometry, and nuclear magnetic resonance for structural confirmation. These methods can distinguish GW501516 from related PPAR agonists and from unrelated steroids. For regulators and researchers, such verification is central to interpreting both biological results and adverse event reports.
Protein primary structure is the linear sequence of amino acids in a peptide or protein. By convention, the primary structure of a protein is reported starting from the amino-terminal (N) end to the carboxyl-terminal (C) end. Protein biosynthesis is most commonly performed by ribosomes in cells. Peptides can also be synthesized in the laboratory. Protein primary structures can be directly sequenced, or inferred from DNA sequences.
Shooting the elephant to take its tusks: this method is of concern here. Taking tusks from an elephant which has died of natural causes. Taking tusks from an elephant which has had to be put down for another reason, for example, severe arthritis, or if its last molar teeth are worn out and can no longer chew its food. Among working elephants which use their tusks to carry logs, there is an optimal tusk length. In former times, tusks were often cut back to this length (and often the shortened tusks' ends were bound in copper). This periodically freed pieces of ivory for the carving trade.
=== Penicillin G === Penicillin G is destroyed by stomach acid, so it cannot be taken by mouth, but doses as high as 2.4 g can be given (much higher than penicillin V). It is given by intravenous or intramuscular injection. It can be formulated as an insoluble salt, and there are two such formulations in current use: procaine penicillin and benzathine benzylpenicillin. When a high concentration in the blood must be maintained, penicillin G must be administered at relatively frequent intervals, because it is eliminated quite rapidly from the bloodstream by the kidney. Penicillin G is licensed for use to treat septicaemia, empyema, pneumonia, pericarditis, endocarditis and meningitis caused by susceptible strains of staphylococci and streptococci. It is also licensed for the treatment of anthrax, actinomycosis, cervicofacial disease, thoracic and abdominal disease, clostridial infections, botulism, gas gangrene (with accompanying debridement and/or surgery as indicated), tetanus (as an adjunctive therapy to human tetanus immune globulin), diphtheria (as an adjunctive therapy to antitoxin and for the prevention of the carrier state), erysipelothrix endocarditis, fusospirochetosis (severe infections of the oropharynx, lower respiratory tract and genital area), Listeria infections, meningitis, endocarditis, Pasteurella infections including bacteraemia and meningitis, Haverhill fever; rat-bite fever and disseminated gonococcal infections, meningococcal meningitis and/or septicaemia caused by penicillin-susceptible organisms and syphilis.
Sources: en.wikipedia.org
== Safety == Diallyl disulfide is a skin irritant and an allergen. In particular, it is the main cause of garlic allergy (allergic contact dermatitis to garlic). The allergy usually starts at the fingertips and cannot be prevented by wearing gloves because diallyl disulfide penetrates through most commercial glove types. The median lethal dose (LD50) for oral intake in rats is 260 mg per kg of body weight and it is 3.6 g/kg for dermal intake. High doses of 5 g/kg placed on the skin of cats cause death through hemolytic anemia. Diallyl disulfide can be easily detected in the air or in the blood with gas chromatography. Dermal emission of diallyl disulfide can be measured by gas chromatography following collection of skin gas samples.
Clostripain (EC 3.4.22.8, clostridiopeptidase B, clostridium histolyticum proteinase B, alpha-clostridipain, clostridiopeptidase, Endoproteinase Arg-C) is a cysteine protease that cleaves proteins on the carboxyl peptide bond of arginine. It was isolated from Clostridium histolyticum. The isoelectric point of the enzyme is 4.8-4.9 (at 8 °C), and optimum pH is 7.4~7.8 (against α-benzoyl-arginine ethyl ester). The composition of the enzyme is indicated to be of two chains of relative molecular mass 45,000 and 12,500.
=== Evolution === The ancestors of American black bears and Asian black bears diverged from sun bears 4.58 mya. The American black bear then split from the Asian black bear 4.08 mya. A small, primitive bear genus called protarctos (U. abstrusus) is the oldest known North American fossil member of the genus Ursus, dated to 4.95 mya. This suggests that U. abstrusus may be the direct ancestor of the American black bear, which evolved in North America. The earliest American black bear fossils, from the Early Pleistocene of Port Kennedy, Pennsylvania, greatly resemble the Asian species, though later specimens grew to sizes comparable to grizzly bears. Once described as a precursor species (Ursus vitabilis), these specimens have been synonymized with U. americanus. The American black bear lived during the same period as the giant and lesser short-faced bears (Arctodus simus and A. pristinus, respectively) and the Florida spectacled bear (Tremarctos floridanus). These tremarctine bears evolved from bears that had emigrated from Asia to the Americas 7–8 mya. The giant and lesser short-faced bears are thought to have been heavily carnivorous and the Florida spectacled bear more herbivorous, while the American black bears remained arboreal omnivores, like their Asian ancestors. From the Holocene to the present, American black bears seem to have shrunk in size, but this has been disputed because of problems with dating these fossil specimens.
Biotechniques Laboratory electrophoresis demonstration, from the University of Utah's Genetic Science Learning Center Discontinuous native protein gel electrophoresis[link removed] Drinking straw electrophoresis How to run a DNA or RNA gel Animation of gel analysis of DNA restriction Step by step photos of running a gel and extracting DNA A typical method from wikiversity
Sources: en.wikipedia.org
When the analytical concentration of methylamine is twice that of ethylenediamine and the concentration of copper is the same in both reactions, the concentration [Cu(en)]2+ is much higher than the concentration [Cu(MeNH2)2]2+ because β11 ≫ β12. The difference between the two stability constants is mainly due to the difference in the standard entropy change, ΔS⊖. In the reaction with the chelating ligand there are two particles on the left and one on the right, whereas in equation with the monodentate ligand there are three particles on the left and one on the right. This means that less entropy of disorder is lost when the chelate complex is formed than when the complex with monodentate ligands is formed. This is one of the factors contributing to the entropy difference. Other factors include solvation changes and ring formation. Some experimental data to illustrate the effect are shown in the following table.
October 23, denoted 10/23 in the US, is recognized by some as Mole Day. It is an informal holiday in honor of the unit among chemists. The date is derived from the Avogadro number, which is approximately 6.022×1023. It starts at 6:02 a.m. and ends at 6:02 p.m. Alternatively, some chemists celebrate June 2 (06/02), June 22 (6/22), or 6 February (06.02), a reference to the 6.02 or 6.022 part of the constant.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
Sources: en.wikipedia.org
Rodent studies reported increased endurance and fat oxidation after GW501516 exposure. Long-term studies also found higher rates of some tumors, which led to halted development.
Small short-term human trials examined metabolic markers such as lipids and glucose. The trials did not continue after rodent cancer findings, so long-term human safety is unknown.
Controlled human trials have not established a performance benefit. Anecdotal reports exist, but they are not reliable evidence.
Anti-doping and clinical laboratories commonly use liquid chromatography-tandem mass spectrometry. The method can identify GW501516 and its metabolites in urine or blood. Detection depends on sample timing and the amount present.